Question: Given below is a processed, mature mRNA sequence corresponding
to a short protein:
CCAGGAUGACGCUA…
Given below is a processed, mature mRNA sequence corresponding
to a short protein:
CCAGGAUGACGCUAGCCGCAGCGAGCCACUAGGAGGAUGAGGGACCUAAAAAAAAA How many
amino acids will the protein translated from this mRNA sequence
have? I got the answer 9 and it was incorrect
(Visited 5 times, 1 visits today)
Related posts:
- Question: Question 3 Match The Following Steps Of Protein Synthesis In The Order That They Occur DNA Creates MRNA With A Template For The Desired Protein [Choose MRNA Attaches To A Ribosome [Choose C MRNA Signals TRNA Which Brings The Required AA Choose TORNA Leaves The Nucleus Choose AA Attach To Each Other An Create New Protein Strand Choose Question 4 Which …
- Question: The mature mRNA will leave the nucleus and binds to a ribosome. Show the sequence of amino acid c…
- Question: The E. coli Lac operon produces a polycistronic mRNA, an mRNA with three protein-coding regions (…
- Question: Gene Expression Worksheet This Sequence Below Is Double-stranded DNA, And Is Part Of A Gene. Assume The Promoter Is On The Left, And Transcription Proceeds Left To Right, Using The Bottom Strand Of The DNA As The Template. Once Transcribed Into RNA, Use The Genetic Code Table (on The Back, Or From Your Textbook) To Create An Amino Acid (Protein) Sequence. …
- Question: Question 3 A. What Determines If Protein Is A “high-quality”? B. What Is Protein-energy Malnutrition (PEM)? Describe In Detail Marasmus And Kwashiorkor. C. What Are The Negative Health Effects Of Dietary Protein? What Is The Recommended Protein Intake Based On The RDA? Do Americans Typically Get Too Much Or Too Little Protein In Their Diet?
- Question: QUESTION Intrat D. Nerve Damage QUESTION A Dietitian Is Working On The Following Diet Ordet For Renal Patient Peutely How Many Grams Of High Biological Protein Should She Add To This Parents Which A. 20 Grams Of HBV Protein, From The Meat And Milk Groups B. 40 Grams Of HBV Protein, From Bread And Vegetable Groups C. HBV Protein Is Not Important In A …
- Question: Question 25 (1 Point) Listen Connor Is A 3 Year-old Boy Who Is Consuming 12 Grams/protein A Day. He Weighs 36.5 Lbs. Is He Getting The Recommended RDA Amount Of Protein Needed For His Age? The Following Information Is Provided: Protein RDA For Children: 1 – 3 Years: 1.05 G/kg/day 1 Kg = 2.2 Lbs. No, He Is Under Consuming The RDA For Protein For His …
- Question: Search This Course 1. Lists Foods That Provided You With The Most Protein On This Day. For Each Of These Foods, State The Grams Of Protein And The Grams Of Fat. Refer To The Fat (e) Column For This Information. Do The Foods That Have A Lot Of Protein Also Contain A Lot Of Fat? To Lower The Fat Intaker, What Alternative Protein Containing Foods Would …
- Question: If A Friend Eats About 1800 Calories A Day, And Has 31% Of Her Calories From Fat, 58% From Carb, And 11% From Protein, How Many Grams Is She Consuming Of Each? 558g Fat, 1,044g Carbs, 198g Protein 139g Fat, 116g Carbs, 49.5g Protein 62g Fat, 261g Carbs, 49.5g Protein None Of The Above
- Question: SAQ (Short Answer Questions) Instructions: A. Provide Short Answers To The Given Statements Or Questions Below. B. Each Question Will Be Given A 1 Mark Each. C. Answer The Following Questions Independently. 1. Known As The Process For Objectively And Systematically Monitoring And Evaluating The Quality And Appropriateness Of Patient Care, Pursuing Opportunities…