Question: 1. The sequence below represents the coding region of a gene
flanked by some 5’ and 3’ UTR sequen…
1. The sequence below represents the coding region of a gene
flanked by some 5’ and 3’ UTR sequence. The start and stop codons
of the coding region are bolded.
accgcggccgcgcttgacgaattcgcttacgctatcaagcttcagatggtgcacctgactcctgaggagaagtctgccgttactgccctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggctgctggtggtctacccttggacccagaggttccttgagtcctttggggatctgtccactcctgatgctgttatgggcaaccctaaggtgaaggctcatggcaagaaagtgctcggtgcctttagtgatggcctggctcacctggacaacctcaagggcacctttgccacactgagtgagctgcactgtgacaagctgcacgtggatcctgagaacttcaggctcctgggcaacgtgctggtctgtgtgctggcccatcactttggcaaagaattcaccccaccagtgcaggctgcctatcagaaagtggtggctggtgtggctaatgccctggcccacaagtatcactaactaaatcgtctaagcaaagcttgcatatataatagcggccgcgcctt
Webcutter 2.0 is one of many on-line programs designed to
identify restriction sites within a submitted sequence of DNA.
a. Find this program on the web and copy and paste the above
sequence to search for a specific set of restriction enzyme
recognition sites. In your search: -Select a linear sequence
analysis. -Display the restriction sites as a “map of restriction
sites” and “table of sites, sorted alphabetically by enzyme name”.
-Choose to display “all” the enzymes that you will be selecting
next. -Only include in your analysis: BamHI, DpnI, EcoRI, HindIII,
HinfI, NotI Hold down ‘ctrl’ as you select these enzymes from the
given list. This will ensure that they are all highlighted and
included in the analysis.
i. Analyze the sequence and print the results page. Then answer
the following questions:
ii. Which enzymes cut once and which enzymes cut twice within
the sequence?
iii. Why would you expect to see more sites for DpnI than sites
for BamHI?
iv. Which enzymes cut outside of the coding region of the
gene?
