Question: The following DNA fragment was sequenced by the Sanger method. The asterisk indicates a fluoresce…

The following DNA fragment was sequenced by the Sanger
method.

The asterisk indicates a fluorescent label on the sequencing
primer.

*5’ _______

3’-OH 3’ _______ ATTACGCAAGGACATTAGAC

A sample of the DNA was reacted with DNA polymerase and several
different nucleotide mixtures in an appropriate buffer. One of the
mixes of deoxynucleotides (dNTP) and dideoxynucleotides (ddNTP,
added in a relatively small amount) is dATP, dTTP, dCTP, ddGTP, but
the student forgot to add the dGTP to this mix. Excluding the
smallest band (the labeled un-extended primer), how many bands and
relative approximate length will you expect to appear in the gel
lane for this mix?

a. 0

b. 1(short)

c. 2 (one short and one intermediate)

d. 1 (intermediate)

e. 1 (long)