Graphical view of primer pairs Tools - Tracks 5 Query_1 - Find: Template 100 200 1300 1400 500 1600 700 1800 1900 1 K 11.100

  • Take your primer sequences for the human insulin gene and addnucleotides at the 5 ‘ end to engineer a restriction site in theprimers. The restriction site should not be present in the insulingene, but it should be present in the cloning vector that yousubmitted in assignment 11.

Show transcribed image text

Transcribed Image Text from this Question

Graphical view of primer pairs Tools – Tracks 5 Query_1 – Find: Template 100 200 1300 1400 500 1600 700 1800 1900 1 K 11.100 1,200 11.300 1.431 (U) Primer pairs for job hy9aybx3uF-fYb1ksASZVsofiGInDJN… , Primer 11 Primer 2 Primer 3 Primer 4 109 300 400 500 609 700 800 999 1 K 1.100 1,200 11.309 1.431 200 Query_1:1..1.4K (1,431 nt) Loading… Detailed primer reports Primer pair 1 Sequence (5->3′) Template strand Length Start Stop Tm GC% Self complementarity Self 3′ complementarity Forward primer CTACCTAGTGTGCGGGGAAC Plus 20 355 374 59.82 60.00 4.00 1.00 Reverse primer AAAAGTGCACCTGACCCCCT Minus 20 549 530 61.66 55.00 6.00 0.00 Product length 195 Primer pair 2 Sequence (5->3′) Template strand Length Start Stop Tm GC% Self complementarity Self 3′ complementarity Forward primer GTCAGGTGGGCTCAGGATTC Plus 20 64 83 60.11 60.00 4.00 3.00 Reverse primer CAATGGGCAGTTGGCTCACC Minus 20 444 425 61.88 60.00 4.00 2.00 Product length 381 Primer pair 3 Template Self Self 3 Sequence (5->3′) strand Length Start Stop Tm GC% complementarity complementarity Forward GGGGTCAGGTGCACTTTTT Plus 19 532 550 58.18 52.63 6.00 primer Reverse primer CACTGGGTGTGGACCTACAG Minus 20 1047 1028 59.68 60.00 5.00 3.00 Product length 516 Primer pair 4 Template Self Self 3 Sequence (5′->3′) strand Length Start Stop Tm GC% complementarity complementarity Forward CAGCCTTTGTGAACCAACACC Plus 21 306 326 60.20 52.38 4.00 primer Reverse AAAAGTGCACCTGACCCCCTG Minus 21 549 529 62.83 57.14 6.00 1.00 primer Product length 244 0.00 0.00
(Visited 3 times, 1 visits today)
Translate »