Question: A double stranded fragment of viral DNA, one of whose strand is shown below, encodes two peptides…

A double stranded fragment of viral DNA, one of whose strand is
shown below, encodes two peptides, called vir-1 and vir-2. Adding
ths doulbe-stranded DNA fragment to an in vitro transcription and
translation system yields peptides with 10 (virA) and five residues
(vir-2). AGATCGGATGCTCAACTATATGTGATTAACAGAGCATGCGGCATAAACT 1.)
Identify the DNA sequences that encode each peptide. 2.) Determine
the amino acid sequence of each peptide. 3.) In a mutant viral
strain, the T at position 23 has been replaced with G. Determine
the amino acid sequence of the two peptides encoded by the mutant
virus.