Question: A portion of the coding sequence of a cloned gene is shown here: 5′–GCCCCCGATCTACATCATTACGGCGAT–3…

A portion of the coding sequence of a cloned gene is shown here:
5′–GCCCCCGATCTACATCATTACGGCGAT–3′ 3′–CGGGGGCTAGATGTAGTAATGCCGCTA–5′
This portion of the gene encodes a polypeptide with the amino acid
sequence alanine—proline—aspartic
acid—leucine—histidine—histidine—tyrosine—glycine—aspartic acid.
Using the method of site-directed mutagenesis, a researcher wants
to change the leucine codon into an arginine codon, with an
oligonucleotide that is 19 nucleotides long. What is the sequence
of the oligonucleotide that should be made? You should designate
the 5′ and 3′ ends of the oligonucleotide in your answer. Note: The
mismatch should be in the middle of the oligonucleotide, and a
one-base mismatch is preferable over a two- or three-base mismatch.
Use the bottom strand as the template strand for this site-directed
mutagenesis experiment.