Question: Consider the following DNA sequences written 5 rightarrow 3 5′-CGA7TCATTAGCCCCTCGTCTGAGCTTTGACAT…
Show transcribed image text Consider the following DNA sequences written 5 rightarrow 3 5'-CGA7TCATTAGCCCCTCGTCTGAGCTTTGACATTTGGCGTCGCCGGCGAATCTCAGGTGCATATAATCAGTC ATGCCCTTACGCTGTTAGTTGCCAGCCCGCCATGACGTTGCAGGCGGGCTTTTTTTTTTTTTTTTTT-3' Determine whether the DNA is from a prokaryote or a eukaryote. If a gene is present, provide the Amino acid sequence for the gene. If possible, determine the type of terminator present.
Consider the following DNA sequences written 5 rightarrow 3 5'-CGA7TCATTAGCCCCTCGTCTGAGCTTTGACATTTGGCGTCGCCGGCGAATCTCAGGTGCATATAATCAGTC ATGCCCTTACGCTGTTAGTTGCCAGCCCGCCATGACGTTGCAGGCGGGCTTTTTTTTTTTTTTTTTT-3' Determine whether the DNA is from a prokaryote or a eukaryote. If a gene is present, provide the Amino acid sequence for the gene. If possible, determine the type of terminator present.
