Question: Library construction and screening (course objectives 1. 2, 3 and 4) Definitions ( 1 pt) (either …
Show transcribed image text Library construction and screening (course objectives 1. 2, 3 and 4) Definitions ( 1 pt) (either correct or not- no partial, so be careful) When making a genomic DNA library, it is common to start with 10 ug of genomic DNA. Your liver preparation was diluted ( luL with 249 uL of water) and the absorbance of the diluted sample at 260 nm was 0.035. How much of the undiluted sample will you need to use to make the library? (Show math for partial credit) Write the sequence of a probe that would hybridize to the upper sequence at 28 degree C. but not to the lower sequence at 28 degree C. (Make sure that you label the ends of your probe correctly. Underline the area that hybridization will occur on the top sequence.) ATCGACGACTATCGCGAGCTATACGCGATTCTATCGCGATCGATCG3'
Library construction and screening (course objectives 1. 2, 3 and 4) Definitions ( 1 pt) (either correct or not- no partial, so be careful) When making a genomic DNA library, it is common to start with 10 ug of genomic DNA. Your liver preparation was diluted ( luL with 249 uL of water) and the absorbance of the diluted sample at 260 nm was 0.035. How much of the undiluted sample will you need to use to make the library? (Show math for partial credit) Write the sequence of a probe that would hybridize to the upper sequence at 28 degree C. but not to the lower sequence at 28 degree C. (Make sure that you label the ends of your probe correctly. Underline the area that hybridization will occur on the top sequence.) ATCGACGACTATCGCGAGCTATACGCGATTCTATCGCGATCGATCG3'
