Question: You sequence a linear piece of DNA by first fragmenting many copies of it into smaller, overlappi…
Show transcribed image text You sequence a linear piece of DNA by first fragmenting many copies of it into smaller, overlapping pieces, each of which is sequenced. Six fragments are shown below. Assemble the pieces into a single contig. How many basepairs long is your contig? (to make the assembly easier, make sure you retain a fixed width font for your DNA fragments, like Courier New. You can use the word count feature in Microsoft word to count the characters easily.) TAACGATCAATTTACTTTTAAAAGAT TTTGGTAATTCAACAT CAATGGTAATGATATTACATCAGAGATTCAATCATTAAATAACGATCAA TTCAACATCATTAATTCAAGTTTAT AATTCAAGTTTATTTCAATGGTAATGAT ATGGTAAT GATAT TACAT CAGAGA 90 bp 94 bp 100 bp 105 bp
You sequence a linear piece of DNA by first fragmenting many copies of it into smaller, overlapping pieces, each of which is sequenced. Six fragments are shown below. Assemble the pieces into a single contig. How many basepairs long is your contig? (to make the assembly easier, make sure you retain a fixed width font for your DNA fragments, like Courier New. You can use the word count feature in Microsoft word to count the characters easily.) TAACGATCAATTTACTTTTAAAAGAT TTTGGTAATTCAACAT CAATGGTAATGATATTACATCAGAGATTCAATCATTAAATAACGATCAA TTCAACATCATTAATTCAAGTTTAT AATTCAAGTTTATTTCAATGGTAATGAT ATGGTAAT GATAT TACAT CAGAGA 90 bp 94 bp 100 bp 105 bp
